Rotating a 2D Vector

Hi. I have a Vector of Vectors that I need to rotate 90 degrees clockwise and 90 degrees counter-clockwise. I got it to rotate Clockwise, but whatever I try, I can't get it to rotate counter clock-wise. The 2D Vector is not always going to be a square. It will mostly be a rectangle. Can anyone... (Read More)

New Poster needs asp form help

I'm very new to ASP and I'm trying to get a radio button group to work and it doesn't. Here's what I have: If Request.Form("RadioGroup1")(1) <> "" Then messBody = messBody & "New" & vbCrLf & vbCrLf If Request.Form("RadioGroup1")(2) <> "" Then messBody = messBody & "Used" & vbCrLf & vbCrLf If... (Read More)

How to delete blank lines in a file??

Hello everyone, My file has lines like: >9|102396631|genome..... CCACTTTCTCTCCGCGCTGGGTTGAACATGGTACATCAGACTCCCTGAATCTGTCAGATC TCTTGGTTGCTGTTGACAACTAAGACTTCGGAGCCTGGAG_GATTTGTTGAGGGGGAGCA (Read More)

Heylo

Hey, thanks for having me here at DaniWeb... Heres a little questionairre: Name: Mike Nickname: HazeyDaze, as well as others Height: 6'1" Weight: um, 200ish Hair: Brown, I think. Eyes: Beautifully gorgeous Green-ish blue... Location: NY (Read More)

need suggestions

hello every one. this is my last year in cs,i'll soon make a thesis but I have'nt decided a proposal yet. here's some topics that our thesis advisor suggested.(i'm not decided yet which one would be the best proposals) *Implementation of the Traveling Salesman Algorithm on Networking... (Read More)

need suggestions

hello every one. this is my last year in cs,i'll soon make a thesis but I have'nt decided a proposal yet. here's some topics that our thesis advisor suggested.(i'm not decided yet which one would be the best proposals) *Implementation of the Traveling Salesman Algorithm on Networking... (Read More)

how to compile?

how to compile c++ program when we r using two different functions which are defined in different file(s) under same directory in linux gcc??? (Read More)

curved edge

im trying to draw a curved line using mouse. there are three points on a straight line. a starting point, an ending point and a point in between. i want to draw a curved line by dragging the middle point in any direction. the other two points remain constant. (Read More)

importing a variable

How do I import a variable from another function in the same class class W(object): #my class def variable(self): #one of my functions f = 5 def printf(self): #what do i put here to import f from the function variable... (Read More)

Are Google & Microsoft Switching Roles?

I've speculated in the past (http://www.daniweb.com/blogs/entry4290.html) that nothing could keep Google from moving Android from a phone to a computer. After all a phone is just a hand-held computer, so it should come as no surprise that Google officially announced... (Read More)

And Now Google Wants My Netbook Too

Yesterday, Google (http://www.google.com) announced (http://googleblog.blogspot.com/2009/07/introducing-google-chrome-os.html) that they are entering the Netbook operating system market with the Google Chrome OS--a Linux-based, web-oriented effort. On the surface, I see this as yet another ploy to... (Read More)

Phorm being dropped faster than a whore's drawers

In what must go down as one the biggest tech u-turns of the century so far, the ISP that was quite happy to undertake Internet snooping trials without informing those customers being spied upon has changed its mind about Phorm WebWise. BT, the biggest Internet Service Provider in the UK, has... (Read More)

Google declares war on Microsoft - but what about Europe?

Google (http://www.google.com) has confirmed that it is working on an operating system called Chrome (http://googleblog.blogspot.com/2009/07/introducing-google-chrome-os.html). It will be a rival to Microsoft (http://www.microsoft.com) Windows, a zillion flavours of Linux... (Read More)

Forget Firefox 3.5, should Opera fear Fennec?

OK, so Firefox 3.5 is out and looking good but why should Opera care? After all, the alternative web browser from years back has long since lost that title to Firefox, at least as far as the desktop is concerned. But what about in the mobile market? Opera has been making real progress... (Read More)

Searching someone who can help in C++

Hi i have to make this work... //INFO: -eingabeprüfung auf buchstabe/zahl // -eingabeprüfung auf zahlenbereich // -wiederholung einbauen vill... #include <iostream> using namespace std; (Read More)

Ubuntu User, You Have Some Big Issues.

Quick question: What do the following things have in common? A Mythical Horned Rabbit from Douglas, Wyoming. A French-Canadian Linux Guy. An A4 Format. An African Word. A Double-sided DVD. An Abundance of Information. Give up? (Read More)

Surprised CompuServe Lasted This Long

My colleague Steven J. Vaughan-Nichols waxed nostalgically on Monday in his Computerworld Cyber Cynic (http://blogs.computerworld.com/so_long_compuserve_nice_to_have_known_you) blog about CompuServe, the long-time service that shut down recently, and which Vaughan-Nichols says he's going to miss.... (Read More)

YouTube serves up 621 million ads in one month

comScore (http://www.comscore.com) has just published data from the Video Metrix service which shows that the number of online videos being viewed here in the UK is up 47 percent on a year ago and fast approaching 5 billion in April 2009 when the measuring period ended. Google did best out of the... (Read More)

Microsoft Ads Enough to Make You Puke

Over the last year, Microsoft ads have been simply bad on one end of the spectrum and horrible on the other. It's really time for the company to reconsider their ad agency choices and their overall strategy because right now they are throwing good money after bad. I had one friend who described the... (Read More)

Facebook and MI6

Facebook (www.facebook.com)'s page on which the location of the head of MI6's flat was available has been taken down. You also can no longer find information about his family and their whereabouts, which you could on the site previously. There has been a debate about this, of course. For Americans... (Read More)

New/Rare Trojan Re-spawning and AVG not working?

Hi, I'm sorry to just join and ask, but this was the only place I could think of that could possibly help! I've got this strange trojan on my laptop and it's re-spawning everytime AVG moves it or heals it. It's a BackDoor.Generic11.ZNE and the file is c:\Windows\System32\hjgruimimnkj.dll. I'm... (Read More)

Copying a microsoft word doc

I have 2 binaries - a java binary that requests a microsoft word doc from a c++ binary. The C++ binary opens the word doc in binary mode, reads x no of chars and returns chars to java binary. Java binary eventually receives all data and writes data using filestream write. When I try to open the... (Read More)

Add/Remove rows from Table

Hello Frndz i m in complete mess... i have to a table with Add/Remove rows features... it should look like this - textbox1 | textbox2 | Add Button after clicking the add button Row will append and Disable the textbox with values...!!! It looks like this after clickin Add Button.. (Read More)

need some help with C string

i am supposed to make 2 functions called find and they are supposed to find a character or string if they are similar when i do this progam gives me weird error: "use of search ambigious" "first declared as class search here. //main #include <iostream> #include <cstdlib> using namespace std; (Read More)

Simply Search Engine

i am newbie in C#. i would like to make a button to function as search button to search by name and search by date. When i key in data inside textbox1 for search by name ,then press search ,can get the data from database. Same case to textbox2 for search by date, then press search. Besides, i can... (Read More)